About

Eduardo Blumwald is a Distinguished Professor and Will W. Lester Endowed Chair at the Department of Plant Sciences at UC Davis. He holds a Ph.D. from Hebrew University of Jerusalem and the University of California, Berkeley, with a focus on bioenergetics, complemented by a Master’s degree in Plant Physiology and a Bachelor’s in Soil and Water Sciences from Hebrew University. His research employs a Systems Biology approach, integrating genomics, proteomics, metabolomics, and enzyme function analysis to identify genes and gene networks that mediate crop plant responses to abiotic stresses. His work emphasizes mechanisms related to ion homeostasis, source/sink relationships, and nutrient use efficiency, aiming to generate transgenic crops with enhanced stress tolerance and improved yields. Blumwald’s current projects include improving biomass production in poplar under abiotic stress conditions through integrated omics, bioinformatics, synthetic biology, and genetic engineering; studying plant water management behavior; engineering nitrogen-fixing rice; and enhancing peanut transformation and nutritional quality. He is actively involved in teaching plant science laboratory courses, plant biotechnology, and graduate core courses. His external activities include serving as Editor-in-Chief for plant science journals, participating in editorial boards, and contributing to the American Society of Plant Biologists. Blumwald has received numerous awards and honors, including being named a Fellow of the American Society of Plant Biologists and the AAAS, and has been recognized as a highly cited researcher multiple times.

Research topics

• Biology
• Botany
• Agronomy
• Biochemistry
• Agroforestry
• Environmental science
• Cell biology
• Ecology

Selected publications

• Increased Apigenin in <scp>DNA</scp> ‐Edited Hexaploid Wheat Promoted Soil Bacterial Nitrogen Fixation and Improved Grain Yield Under Limiting Nitrogen Fertiliser

  Plant Biotechnology Journal · 2025-08-06 · 3 citations

  articleOpen accessSenior authorCorresponding

  Nitrogen availability remains a principal constraint to crop productivity. Plants cannot directly assimilate the abundant nitrogen available in our atmosphere; instead, they rely on the uptake of inorganic forms of nitrogen, such as ammonium and nitrate from the soil. Nitrogen is a limiting nutrient in wheat production, and wheat yields are very responsive to nitrogen fertilisation. Only diazotrophic bacteria can convert atmospheric nitrogen to ammonia via biological nitrogen fixation (BNF), and although improving BNF in wheat has been a longstanding objective, there have been no descriptions of successful modification of wheat crops showing increased BNF in the literature. Here we describe the use of polycistronic multiplexed CRISPR to modify the flavone biosynthetic pathway of hexaploid wheat (Triticum aestivum) plants, generating DNA-edited plants with increased apigenin content. The apigenin-enriched plants exude apigenin into the soil, inducing the colonisation of the roots and subsequent formation of biofilms in soil by diazotrophic bacteria. The low permeability of the biofilm to oxygen protected the bacterial nitrogenase and stimulated BN. Under nitrogen-limiting conditions, apigenin-enriched wheat lines exhibited increased nitrogen content, improved photosynthetic performance, and higher grain yield relative to wild-type controls. This work demonstrates the feasibility of engineering associative BNF in cereals via metabolic reprogramming of root exudation, offering a sustainable route to reduce dependence on synthetic nitrogen fertilisers.

  PublisherDOI

• SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach (Final Report)

  2024-01-21

  reportOpen access1st authorCorresponding

  SyPro Poplar: Improving Poplar Biomass Production under Abiotic Stress Conditions: an Integrated Omics, Bioinformatics, Synthetic Biology and Genetic Engineering Approach In the SyPro Poplar project, we aimed to integrate omics, bioinformatics, synthetic biology, and genetic engineering approaches to develop transgenic poplar trees with sustained photosynthetic activity and increased biomass production under individual and the simultaneous occurrence of water deficit, increased soil salinity, and elevated temperatures. Specifically, we intended to (i) study the functions of selected stress-responsive genes at tissue and cell type-specific levels, (ii) discover novel motifs and construct stress-responsive synthetic promoters, and (iii) use these promoters to drive the expression of genes shown to confer abiotic stress tolerance in a variety of crops and develop abiotic stress-tolerant poplars in a coordinated fashion.

  PublisherDOI

• Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar

  Plant Biotechnology Journal · 2024-01-17 · 14 citations

  articleOpen access

  Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

  PublisherOA PDFDOI

• Spatiotemporal metabolic responses to water deficit stress in distinct leaf cell-types of poplar

  Frontiers in Plant Science · 2024-02-29 · 19 citations

  articleOpen access

  The impact of water-deficit (WD) stress on plant metabolism has been predominantly studied at the whole tissue level. However, plant tissues are made of several distinct cell types with unique and differentiated functions, which limits whole tissue ‘omics’-based studies to determine only an averaged molecular signature arising from multiple cell types. Advancements in spatial omics technologies provide an opportunity to understand the molecular mechanisms underlying plant responses to WD stress at distinct cell-type levels. Here, we studied the spatiotemporal metabolic responses of two poplar ( Populus tremula× P. alba ) leaf cell types -palisade and vascular cells- to WD stress using matrix-assisted laser desorption/ionization-mass spectrometry imaging (MALDI-MSI). We identified unique WD stress-mediated metabolic shifts in each leaf cell type when exposed to early and prolonged WD stresses and recovery from stress. During water-limited conditions, flavonoids and phenolic metabolites were exclusively accumulated in leaf palisade cells. However, vascular cells mainly accumulated sugars and fatty acids during stress and recovery conditions, respectively, highlighting the functional divergence of leaf cell types in response to WD stress. By comparing our MALDI-MSI metabolic data with whole leaf tissue gas chromatography-mass spectrometry (GC-MS)-based metabolic profile, we identified only a few metabolites including monosaccharides, hexose phosphates, and palmitic acid that showed a similar accumulation trend at both cell-type and whole leaf tissue levels. Overall, this work highlights the potential of the MSI approach to complement the whole tissue-based metabolomics techniques and provides a novel spatiotemporal understanding of plant metabolic responses to WD stress. This will help engineer specific metabolic pathways at a cellular level in strategic perennial trees like poplars to help withstand future aberrations in environmental conditions and to increase bioenergy sustainability.

  PublisherOA PDFDOI

• Salinity‐Induced Photorespiration in <i>Populus</i> Vascular Tissues Facilitate Nitrogen Reallocation

  Plant Cell & Environment · 2024-10-01 · 3 citations

  articleOpen accessSenior authorCorresponding

  ABSTRACT Adaptation to abiotic stress is critical for the survival of perennial tree species. Salinity affects plant growth and productivity by interfering with major biosynthetic processes. Detrimental effects of salinity may vary between different plant tissues and cell types. However, spatial molecular mechanisms controlling plant responses to salinity stress are not yet thoroughly understood in perennial trees. We used laser capture microdissection in clones of Populus tremula x alba to isolate palisade and vascular cells of intermediary leaf from plants exposed to 150 mM NaCl for 10 days, followed by a recovery period. Cell‐specific changes in proteins and metabolites were determined. Salinity induced a vascular‐specific accumulation of proteins associated with photorespiration, and the accumulation of serine, 3‐phosphoglycerate and NH 4 + suggesting changes in N metabolism. Accumulation of the GLUTAMINE SYNTHETASE 2 protein, and increased GS1.1 gene expression, indicated that NH 4 + produced in photorespiration was assimilated to glutamine, the main amino acid translocated in Populus trees. Further analysis of total soluble proteins in stems and roots showed the accumulation of bark storage proteins induced by the salinity treatments. Collectively, our results suggest that the salt‐induced photorespiration in vascular cells mediates N‐reallocation in Populus , an essential process for the adaptation of trees to adverse conditions.

  PublisherOA PDFDOI

• Stress-induced endocytosis from chloroplast inner envelope membrane is mediated by CHLOROPLAST VESICULATION but inhibited by GAPC

  Cell Reports · 2023-10-01 · 19 citations

  articleOpen access

  Clathrin-mediated vesicular formation and trafficking are responsible for molecular cargo transport and signal transduction among organelles. Our previous study shows that CHLOROPLAST VESICULATION (CV)-containing vesicles (CVVs) are generated from chloroplasts for chloroplast degradation under abiotic stress. Here, we show that CV interacts with the clathrin heavy chain (CHC) and induces vesicle budding toward the cytosol from the chloroplast inner envelope membrane. In the defective mutants of CHC2 and the dynamin-encoding DRP1A, CVV budding and releasing from chloroplast are impeded. The mutations of CHC2 inhibit CV-induced chloroplast degradation and hypersensitivity to water stress. Moreover, CV-CHC2 interaction is impaired by the oxidized GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE (GAPC). GAPC1 overexpression suppresses CV-mediated chloroplast degradation and hypersensitivity to water stress, while CV silencing alleviates the hypersensitivity of the gapc1gapc2 plant to water stress. Together, our work identifies a pathway of clathrin-assisted CVV budding outward from chloroplast, which is involved in chloroplast degradation and stress response.

  PublisherOA PDFDOI

• Welcoming new editors for Plant Science

  Plant Science · 2023-01-02

  editorial1st authorCorresponding
  PublisherDOI

• Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation

  BIO-PROTOCOL · 2023-01-01 · 7 citations

  articleOpen access

  Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

  PublisherDOI

• CRISPR/Cas9-mediated knockout of a polyester synthase-like gene delays flowering time in alfalfa

  Plant Cell Reports · 2023-02-25 · 4 citations

  article
  PublisherDOI

• The reference genome and abiotic stress responses of the model perennial grass <i>Brachypodium sylvaticum</i>

  G3 Genes Genomes Genetics · 2023-10-26 · 7 citations

  articleOpen access

  Perennial grasses are important forage crops and emerging biomass crops and have the potential to be more sustainable grain crops. However, most perennial grass crops are difficult experimental subjects due to their large size, difficult genetics, and/or their recalcitrance to transformation. Thus, a tractable model perennial grass could be used to rapidly make discoveries that can be translated to perennial grass crops. Brachypodium sylvaticum has the potential to serve as such a model because of its small size, rapid generation time, simple genetics, and transformability. Here, we provide a high-quality genome assembly and annotation for B. sylvaticum, an essential resource for a modern model system. In addition, we conducted transcriptomic studies under 4 abiotic stresses (water, heat, salt, and freezing). Our results indicate that crowns are more responsive to freezing than leaves which may help them overwinter. We observed extensive transcriptional responses with varying temporal dynamics to all abiotic stresses, including classic heat-responsive genes. These results can be used to form testable hypotheses about how perennial grasses respond to these stresses. Taken together, these results will allow B. sylvaticum to serve as a truly tractable perennial model system.

  PublisherOA PDFDOI

Recent grants

• Collaborative Research: Arabidopsis NHX-like Vacuolar Antiporters: Structure and Function

  NSF · $491k · 2004–2009

• Collaborative Research: Abiotic Stress Combination: Bridging the gap between Arabidopsis Stress Research and Agriculture

  NSF · $229k · 2009–2012

Frequent coauthors

• Amir Ahkami

  29 shared

• Mohsen Hanana

  Center of Biotechnogy of Borj Cédria

  27 shared

• María del Mar Rubio Wilhelmi

  University of California, Davis

  26 shared

• Avi Sadka

  Hebrew University of Jerusalem

  24 shared

• Nir Sade

  Tel Aviv University

  23 shared

• Hiromi Tajima

  University of California, Davis

  23 shared

• Zvi Peleg

  Hebrew University of Jerusalem

  22 shared

• Elias Bassil

  21 shared

Awards & honors

• Corresponding Member, National Academy of Agriculture and Ve…
• Fellow, American Society of Plant Biologists (2014)
• REDBIO, Food and Agriculture Organization of the United Nati…
• Loomis Distinguished Lecturer, Iowa State University (2012)
• Fellow, American Association for the Advancement of Science…